View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3121_low_45 (Length: 213)
Name: NF3121_low_45
Description: NF3121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3121_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 9 - 195
Target Start/End: Complemental strand, 34685132 - 34684946
Alignment:
| Q |
9 |
gagtagcaaaggggagggataaggtttcaaagccgaagaaatgtgaaatgttttgtttgattggaaaaatggtgatgtagttgcagttgtaaagttcttt |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685132 |
gagtagaaaaggggagggataaggtttcaaagccgaagaaatgtgaaatgttttgtttgattggaaaaatggtgatgtagttgcagttgtaaagttcttt |
34685033 |
T |
 |
| Q |
109 |
cttcaggttaatttgacgaaaaatgtgggnnnnnnnggattcatttgagagttgtatttaatttcttccgttatgtatagcatacat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685032 |
cttcaggttaatttgacgaaaaatgtgggtttttttggattcatttgagagttgtatttaatttcttccgttatgtatagcatacat |
34684946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 79 - 136
Target Start/End: Complemental strand, 34693374 - 34693317
Alignment:
| Q |
79 |
ggtgatgtagttgcagttgtaaagttctttcttcaggttaatttgacgaaaaatgtgg |
136 |
Q |
| |
|
||||||||| || || ||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34693374 |
ggtgatgtaatttcaattgcaaagttctttcttcaggttatcttgacgaaaaatgtgg |
34693317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University