View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3123_high_17 (Length: 291)
Name: NF3123_high_17
Description: NF3123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3123_high_17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 17 - 291
Target Start/End: Original strand, 26734986 - 26735260
Alignment:
| Q |
17 |
actctcagtgctcttccttcctcttttcccttctcagccactccactgctaacaaccaccacttcgctaatcgtggcacgtgcaacggcactggagcgag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26734986 |
actctcagtgctcttccttcctcttttcccttctcagccactccactgctaacaaccaccacctcgctaatcgtggcacgtgcaacggcactggagcgag |
26735085 |
T |
 |
| Q |
117 |
tggcacggcacgtgatcagcttgtggttcaattccaagtgcttcgggaagattaattgcaggttagtggaacttctgagttgtacggtgtggttgttgcg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26735086 |
tggcacggcacgtgatcagcttgtggttcaattccaagtgcttcgggaagattagttgcaggttagtggaacttctgagttgtacggtgtggttgttgcg |
26735185 |
T |
 |
| Q |
217 |
gaggagggtggaggagaatctagagatggatgatgacgtggccatgattgaaataaaggttgatgatgaatgagt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26735186 |
gaggagggtggaggagaatctagagatggatgatgacgtggccatgattgaaataaaggttgatgatgaatgagt |
26735260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University