View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3123_high_39 (Length: 208)
Name: NF3123_high_39
Description: NF3123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3123_high_39 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 37340177 - 37339970
Alignment:
| Q |
1 |
ccaatggtttttctctcaccccattcacctactcacgtttcattactgcactctgctccgtcaagaatttcttgctcattgaatccctcctccgcgatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37340177 |
ccaatggtttttctctcaccccattcacctactcacgtttcattactgcactctgctccgtcaagaatttcttgctcattgaatccctcctccgcgatat |
37340078 |
T |
|
| Q |
101 |
ggacgatcttggcatcgttcctgatatttgggcttttaatatctatctcaacattctctgccgtgaaaatcggttagaaactgcacttcaattgtttcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37340077 |
ggacgatcttggcatcgttcctgatatttgggcttttaatatctatctcaacattctctgccgtgaaaatcggttagaaactgcacttcaattgtttcaa |
37339978 |
T |
|
| Q |
201 |
acaatgcc |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
37339977 |
acaatgcc |
37339970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University