View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3123_low_16 (Length: 313)
Name: NF3123_low_16
Description: NF3123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3123_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 306
Target Start/End: Complemental strand, 35312299 - 35312016
Alignment:
| Q |
18 |
ttatgatttcaaagactacagatttgacatttgaattgtcttttcataatctctctctttctc------acacttctctgcagactgaatacacggttgg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35312299 |
ttatgatttcaaagactacagatttgacatttgaattgtcttttcataatctctctctctctctctctcacacttctctgcagactgaatacacggttgg |
35312200 |
T |
 |
| Q |
112 |
aactgcatttcaaattttagcagcttttacttttgcatttcatacgtactactactacttcattactacgtgattcatcaagtatttttacctagcacac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35312199 |
aactgcatttcaaattttagcagcttttacttttgcatttcatacgtactactactactt-----------gattcatcaagtatttttacctagcacac |
35312111 |
T |
 |
| Q |
212 |
acatactactcataaagatttttggacttttctacacttatacgaattttgtactagtctatagtatacgtttaattcaatccagtttcatttca |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35312110 |
acatactactcataaagatttttggacttttctacacttatacgaattttgtactagtctatagtatacgtttaattcaatccagtttcatttca |
35312016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University