View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3123_low_21 (Length: 284)
Name: NF3123_low_21
Description: NF3123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3123_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 121 - 266
Target Start/End: Original strand, 52742219 - 52742351
Alignment:
| Q |
121 |
acggttttactgcctccaagtaaaggttcggctgaactggaagaggctagactgaagggaagtttttagtttagctgttaaactccaacagcctcaacaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52742219 |
acggttttactgcctccaagtaaaggttcagctgaactggaagaggctagactgaagggaagtttttagtttagct-------------agcctcaacaa |
52742305 |
T |
|
| Q |
221 |
ccttcttctcaaaggaatttgtcgcaataaaattggcctctcgtga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52742306 |
ccttcttctcaaaggaatttgtcgcaataaaattggcctctcgtga |
52742351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 207
Target Start/End: Original strand, 28027743 - 28027829
Alignment:
| Q |
121 |
acggttttactgcctccaagtaaaggttcggctgaactggaagaggctagactgaagggaagtttttagtttagctgttaaactcca |
207 |
Q |
| |
|
||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28027743 |
acggttttattgcctccaagtaaaggttcagccgaactggaagaggctagactgaagggaagtttttagtttagctgttaaactcca |
28027829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 52742099 - 52742163
Alignment:
| Q |
1 |
agaaattggtaacagcatagataacatatggaattacagggagatagcccaaaaggttcagctta |
65 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
52742099 |
agaaattggtaatagcatagataacatatggaattccagggagataacccaaaaggttcagctta |
52742163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 14 - 56
Target Start/End: Original strand, 39591548 - 39591590
Alignment:
| Q |
14 |
agcatagataacatatggaattacagggagatagcccaaaagg |
56 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39591548 |
agcatagataacatatggaatttcagggagatagcccaaaagg |
39591590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 8 - 56
Target Start/End: Complemental strand, 52980666 - 52980618
Alignment:
| Q |
8 |
ggtaacagcatagataacatatggaattacagggagatagcccaaaagg |
56 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52980666 |
ggtaatagcatagataacatatggaattctagggagatagcccaaaagg |
52980618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University