View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3123_low_28 (Length: 251)
Name: NF3123_low_28
Description: NF3123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3123_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 52742577 - 52742347
Alignment:
| Q |
1 |
cttctaattttgaaacccttttatcttgtatttgatattttcttcaatatcatgtaataaactagtctttttcagattcagtgtttgtttttaggggttt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52742577 |
cttctaatttcgaaacccttttatcttgtatttgatattttcttcaatatcatgtaataaactagtctttttcaaattcagtgtttgtttttaggggttt |
52742478 |
T |
|
| Q |
101 |
ttgtttggttggaggattcaattcaatacactttgggaatctagggtttgggtcnnnnnnncaatgtgttattttgattattgttattatcgtaattgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52742477 |
ttgtttggttggaggattcaattcaatacactttgggaatctagggtttgggtcttttttttaatgtgttattttgattattgttattatcataattgct |
52742378 |
T |
|
| Q |
201 |
gcgatttctgtgagtgaagagatgcttcacg |
231 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |
|
|
| T |
52742377 |
gccatttctgtgagtgaagagatgcttcacg |
52742347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 111 - 154
Target Start/End: Original strand, 10919400 - 10919443
Alignment:
| Q |
111 |
ggaggattcaattcaatacactttgggaatctagggtttgggtc |
154 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10919400 |
ggaggtttcaattcaatacactttgggaatctagggtttgggtc |
10919443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 165 - 229
Target Start/End: Complemental strand, 2377834 - 2377767
Alignment:
| Q |
165 |
tgtgttattttgattattgtta---ttatcgtaattgctgcgatttctgtgagtgaagagatgcttca |
229 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||| || ||||| |
|
|
| T |
2377834 |
tgtgttattttgattattattactattatcataattgctgcgatttctgtgagtgaagacatacttca |
2377767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 137
Target Start/End: Complemental strand, 2378656 - 2378590
Alignment:
| Q |
69 |
ttttcagattcagtgtttgtttttaggggtttttgtttggttggaggattcaattcaatacactttggg |
137 |
Q |
| |
|
||||||||||||| ||||||||||||| ||| |||||| || ||||||||||||||||||||||||| |
|
|
| T |
2378656 |
ttttcagattcagcgtttgtttttaggtatttg-gtttggatg-aggattcaattcaatacactttggg |
2378590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University