View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3123_low_29 (Length: 250)
Name: NF3123_low_29
Description: NF3123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3123_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 34 - 233
Target Start/End: Complemental strand, 21592707 - 21592508
Alignment:
| Q |
34 |
aaagcatttaaatattagcgacaagttgatttaaaggatgaaactctttggaatatcacaacggttccatttttaataataaaagtttataataactttg |
133 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592707 |
aaagaatttaaatattagcgacaagttgatttaaaggatgaaactctttggaatatcacaacggttccatttttaataataaaagtttataataactttg |
21592608 |
T |
 |
| Q |
134 |
aaataacttttatttcaagatgcatttaaaaatatgtagccttaacataagaaataccaaaataaaaaggaactagaaatcaaattcaatctacagatat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592607 |
aaataacttttatttcaagatgcatttaaaaatatgtagccttaacataagaaataccaaaataaaaaggaactagaaatcaaattcaatctacagatat |
21592508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University