View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3123_low_30 (Length: 250)
Name: NF3123_low_30
Description: NF3123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3123_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 24952283 - 24952039
Alignment:
| Q |
1 |
ccaagctctctctggcattaaacgtctagtgtttcgttgttatgcagcaaaggtgagtgaaattttcattatgcttgtgtattatatatttaaaaaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24952283 |
ccaagctctctctggcattaaacgtctagtgtttcgttgttatgcagcaaaggtgagtgaaattttcattatgcttgtgtattatatatttaaaaaattt |
24952184 |
T |
|
| Q |
101 |
gtgctaattctcgtatctccacttgttgttattgtgtacgtaccaaaagaggagattattaggtactgaacctattatagattttccgaaaatgcacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24952183 |
gtgctaattctcgtatctccacttgttgttgttgtgtacgtaccaaaagaggagattattaggtactgaacctattatagattttccgaaaatgcacttt |
24952084 |
T |
|
| Q |
201 |
tcagaatttcgctgcttactacatctagagcttattcttctcact |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24952083 |
tcagaatttcgctgcttactacatctagagcttattcttcccact |
24952039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 20513797 - 20513726
Alignment:
| Q |
1 |
ccaagctctctctggcattaaacgtctagtgtttcgttgttatgcagcaaaggtgagtgaaattttcattat |
72 |
Q |
| |
|
|||||||||| |||| |||||||||||||| || || |||||| ||||||||||||||||||||||| |||| |
|
|
| T |
20513797 |
ccaagctctcactggaattaaacgtctagtattgcgatgttatacagcaaaggtgagtgaaattttctttat |
20513726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University