View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3123_low_35 (Length: 239)
Name: NF3123_low_35
Description: NF3123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3123_low_35 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 33732394 - 33732617
Alignment:
| Q |
18 |
acttaatggtgctaactataagctggg-tagtcttgtcaaacaaatgtcacaagtttgatgtttattaaattaaaact-agttaagattattattaggta |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
33732394 |
acttaatggtgctaactataagctggggtagtcttgtcaaacaaatgtcacaagtttgatgtttattaaattaaaacttagttaagattattattaggga |
33732493 |
T |
 |
| Q |
116 |
gattggcgaatcgtcgagaaaatgacactaaatctccacctaaaatcttaagacgttgaatattatgaatcatctcttttatatatctaacaccactttt |
215 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33732494 |
gattggcgaatcgctgagaagatgacactaaatctccacctaaaaccttaagacgttgaatattatgaatcacctcttttatatatctaacaccactttt |
33732593 |
T |
 |
| Q |
216 |
tgcattcatagtcgaggtgaaact |
239 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
33732594 |
agcattcagagtcgaggtgaaact |
33732617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University