View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3123_low_38 (Length: 237)
Name: NF3123_low_38
Description: NF3123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3123_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 37468504 - 37468721
Alignment:
| Q |
1 |
ctctacgttacaaaaacataaatcctagaaatttggtttgaccaagtttaggttatggcaacaagtaattcaaccatctaatgttaaggatcgtataacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37468504 |
ctctacgttacaaaaacataaatcctagaaatttggtttgaccaagtttaggttatggcaacaagtaattcaaccatctaatgttaaggatcgtataacg |
37468603 |
T |
|
| Q |
101 |
tcaatatgatctggtcaaaagggaaatttaactaatataatttactttaaaataaattacaagatnnnnnnntaaaacatgtct---atcatcgtacact |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||||| |
|
|
| T |
37468604 |
tcaatatgatctggtcaaaagggaaatttaactaatataatttactttaaaataaattacaagataaaaaaatacaacatgtctatcatcatcgtacact |
37468703 |
T |
|
| Q |
198 |
tgattgttatttgccatt |
215 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
37468704 |
tgatcgttatttgccatt |
37468721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University