View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3124_low_11 (Length: 214)
Name: NF3124_low_11
Description: NF3124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3124_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 20 - 163
Target Start/End: Complemental strand, 21174317 - 21174177
Alignment:
| Q |
20 |
tagtgtcattttaattaataataattttcatctcacccatttttctnnnnnnntcttatttttaactctaattcttggttcaaataagttgaagctataa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21174317 |
tagtgtcattttaattaataataattttcatctcacccatttttctaaaaaaatcttatttttaact---attcttggttcaaataagttgaagctataa |
21174221 |
T |
 |
| Q |
120 |
tcttgaaaaaggtacaagatttttataaaataaaaagaaaattg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21174220 |
tcttgaaaaaggtacaagatttttataaaataaaaagaaaattg |
21174177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University