View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3124_low_13 (Length: 208)
Name: NF3124_low_13
Description: NF3124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3124_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 55653665 - 55653493
Alignment:
| Q |
17 |
gaaggatacatgggaagcttgggaaccatgttgggattcaatgtgctttttcttcatccatgggctgtgtttggctcttcaaattgcgtataagaaggta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55653665 |
gaaggatacatgggaagcttgggaaccatgttgggattcaatgtgctttttcttcatccatggggtgtgtttggctcttcaaattgcgtataagaaggta |
55653566 |
T |
 |
| Q |
117 |
tttgaaccaaaacgtgaattattgccaagggttgtgtcttgtatacttacaatggtttttgtggtgtctactg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55653565 |
tttgaaccaaaacgtgaattattgccaagggttgtgtcttgtatacttacaatggtttttgtggtgtctactg |
55653493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 24 - 171
Target Start/End: Complemental strand, 55662219 - 55662071
Alignment:
| Q |
24 |
acatgggaagcttgggaaccatgttgggattcaatgtgctttttcttcatccatgggc-tgtgtttggctcttcaaattgcgtataagaaggtatttgaa |
122 |
Q |
| |
|
|||||||| |||||||| |||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
55662219 |
acatgggaggcttgggagccatattgggattcaatgtgcttcttcttcatccatgggggtgtgtttggctcttcaaattgaatataagaaggtattcaaa |
55662120 |
T |
 |
| Q |
123 |
ccaaaacgtgaattattgccaagggttgtgtcttgtatacttacaatgg |
171 |
Q |
| |
|
|| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55662119 |
ccgaaaggtgaattattgccaagggttgtgtcttgtatacttacaatgg |
55662071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 24 - 189
Target Start/End: Complemental strand, 4476863 - 4476698
Alignment:
| Q |
24 |
acatgggaagcttgggaaccatgttgggattcaatgtgctttttcttcatccatgggctgtgtttggctcttcaaattgcgtataagaaggtatttgaac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || || |||||||||||| ||||| |||||||| ||||||| || |||||| | || ||| |
|
|
| T |
4476863 |
acatgggaagcttgggaaccatgttgggattcaatgtgtttctttttcatccatggggtgtgtgtggctcttgaaattgcatacaagaagatcttcaaac |
4476764 |
T |
 |
| Q |
124 |
caaaacgtgaattattgccaagggttgtgtcttgtatacttacaatggtttttgtggtgtctactg |
189 |
Q |
| |
|
|||||| | ||||| ||||||||||||||||||| || ||||||| || || |||||||||| |
|
|
| T |
4476763 |
caaaacaccagttattaccaagggttgtgtcttgtaccctcacaatggccttcgttgtgtctactg |
4476698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University