View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3124_low_14 (Length: 205)

Name: NF3124_low_14
Description: NF3124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3124_low_14
NF3124_low_14
[»] scaffold0907 (1 HSPs)
scaffold0907 (20-186)||(2652-2817)


Alignment Details
Target: scaffold0907 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: scaffold0907
Description:

Target: scaffold0907; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 20 - 186
Target Start/End: Complemental strand, 2817 - 2652
Alignment:
20 aatcgtaactcacgtgacttctaggtcttgttctagatgatcgcgtggatattaactagttgtataaataagttctagtagtatttgactatgtgatgta 119  Q
    |||||||||| |||||| |||||| |||  ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2817 aatcgtaactaacgtgatttctagttctaattctagatggtcacgtggatattaactagttgtataaataagttctagtagtatttgactatgtgatgta 2718  T
120 attggtatttggtaagtatatgtctggaccgacgatgagtatgatagaatcacggtgtgttatccaa 186  Q
    ||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||| |||||    
2717 attggtatttggtaagtatatgt-tggtccgacgatgagtatgatagaatcatggtgtgttgtccaa 2652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University