View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3125A-Insertion-14 (Length: 210)
Name: NF3125A-Insertion-14
Description: NF3125A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3125A-Insertion-14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 101 - 149
Target Start/End: Original strand, 7416821 - 7416869
Alignment:
| Q |
101 |
caccagctatagttatagctctctgctccatatcccccagaaatcatgc |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7416821 |
caccagctatagttatagctctctgctccatatcccccagaaatcatgc |
7416869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 7 - 56
Target Start/End: Original strand, 7416738 - 7416787
Alignment:
| Q |
7 |
actatgcagatttttgattgaaggaaaaagatgcgatgcaatgcaatgca |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7416738 |
actatgcagatttttgattgaaggaaaaagatgcaatgcaatgcaatgca |
7416787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University