View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3125A-Insertion-16 (Length: 178)
Name: NF3125A-Insertion-16
Description: NF3125A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3125A-Insertion-16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 8 - 178
Target Start/End: Original strand, 34679960 - 34680129
Alignment:
| Q |
8 |
attcagacacgtatacgtgtttctttgatatgtcaacttcattttagtgtacccaaaatattcccacttttttatttcatatacctaattactatatact |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
34679960 |
attcagacacgtatacgtgtttctttgatatgtcaacttcattttagtgtacccaaaatattcccacttttttatttcatatacctaattacca-gtact |
34680058 |
T |
 |
| Q |
108 |
tatcaaattccacttcacaattactcctaaacaatcaagttcaatttgatgtcactctcaccattaatgtc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34680059 |
tatcaaattccacttcacaattactcctaaacaatccagttcaatttgatgtcactctcaccattaatgtc |
34680129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University