View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3125A-Insertion-8 (Length: 188)
Name: NF3125A-Insertion-8
Description: NF3125A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3125A-Insertion-8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 8e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 8e-86
Query Start/End: Original strand, 8 - 177
Target Start/End: Original strand, 43578961 - 43579130
Alignment:
| Q |
8 |
aagaatgaagataaggtgtatgagatattgcatcggttacgggccgtggttaggcaggtgtctgagtcgactttgaaggttattgaggattggtttgagt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43578961 |
aagaatgaagataaggtgtatgagatattgcatcggttaagggccgtggttaggcaggtgtctgagtcgactttgaaggttattgaggattggtttgagt |
43579060 |
T |
 |
| Q |
108 |
cggaatatgcgatgaagattgggaagagggagtgggatgatgaggagataagagaagggtytgtgagggg |
177 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43579061 |
cggaatatgcgatgaaaattgggaagagggagtgggatgatgaggagataagagaagggtttgtgagggg |
43579130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University