View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3125_high_10 (Length: 304)
Name: NF3125_high_10
Description: NF3125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3125_high_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 280; Significance: 1e-157; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 301
Target Start/End: Original strand, 26806324 - 26806607
Alignment:
| Q |
18 |
cccaacatgtgtttgttttcaacactaacacgcaccaacacatgcgattacatgtaattgtcaagtccggtgtcgtgcttcatagggaggatggtttttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26806324 |
cccaacatgtgtttgttttcaacactaacacgcaccaacacatgcgattacatgtaagtgtcaagtccggtgtcgtgcttcatagggaggatggtttttc |
26806423 |
T |
|
| Q |
118 |
atacttgattggtggaaattatgaataaaacatttttacgcataaatctaccaacttttatttattttattttctccctgttcatatggttcataatgtc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26806424 |
atacttgattggtggaaattatgaataaaacatttttacgcataaatctaccaacttttatttattttattttctccctgttcatatggttcataatgtc |
26806523 |
T |
|
| Q |
218 |
gaattttaatcagagtttgtaagtgctttagttcaattagtagattgtcttattgtaaagtttagccactttcctattgatttt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26806524 |
gaattttaatcagagtttgtaagtgctttagttcaattagtagattgtcttattgtaaagtttagccactttcctattgatttt |
26806607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 55 - 120
Target Start/End: Complemental strand, 27589529 - 27589464
Alignment:
| Q |
55 |
acacatgcgattacatgtaattgtcaagtccggtgtcgtgcttcatagggaggatggtttttcata |
120 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27589529 |
acacatgcgattacatgtaagtgtcgagtccggtgtcatgcttcatagggaggatggtttttcata |
27589464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 55 - 120
Target Start/End: Complemental strand, 27673515 - 27673450
Alignment:
| Q |
55 |
acacatgcgattacatgtaattgtcaagtccggtgtcgtgcttcatagggaggatggtttttcata |
120 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
27673515 |
acacatgcaattacatgtaagtgtcgagtccggtgtcatgcttgatagggaggatggtttttcata |
27673450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 221 - 290
Target Start/End: Complemental strand, 27673415 - 27673346
Alignment:
| Q |
221 |
ttttaatcagagtttgtaagtgctttagttcaattagtagattgtcttattgtaaagtttagccactttc |
290 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||||||| |||| |||| ||||||||| ||||||||||||| |
|
|
| T |
27673415 |
ttttaatcatagtttgcaagtgctgtagttcaattaatagactgtcatattgtaaattttagccactttc |
27673346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 7e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 226 - 284
Target Start/End: Complemental strand, 264518 - 264460
Alignment:
| Q |
226 |
atcagagtttgtaagtgctttagttcaattagtagattgtcttattgtaaagtttagcc |
284 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
264518 |
atcagagtttgcaagtgctttagttcaattagtagactgtcttattgtaaattttagcc |
264460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 92 - 139
Target Start/End: Complemental strand, 264564 - 264517
Alignment:
| Q |
92 |
gtgcttcatagggaggatggtttttcatacttgattggtggaaattat |
139 |
Q |
| |
|
|||||||||| | | |||||||||||||||||||||| |||||||||| |
|
|
| T |
264564 |
gtgcttcataagcaagatggtttttcatacttgattgatggaaattat |
264517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University