View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3125_low_15 (Length: 251)
Name: NF3125_low_15
Description: NF3125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3125_low_15 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 4 - 251
Target Start/End: Original strand, 20810642 - 20810889
Alignment:
| Q |
4 |
atgtcgaagaatatagcaacattggtgtatgacctgcgaccattcaaaatcgatgtaaataaatactataaataaatattcatagaaagcatggtcatca |
103 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20810642 |
atgtccaaaaatatagcaacattggtgtatgacctgcgaccattcaaaatcgatgtaaataaatactataaacaaatattcatagaaagcatggtcatca |
20810741 |
T |
|
| Q |
104 |
ttaaggtcatcatgaagttcacgaaaggctgcctccaacacatgacacttttatgggcaaacaacaccctttagatttaggttattaatttgtacacatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20810742 |
ttaaggtcatcatgaagttcacgaaaggctgcctccaacacatgacacttttatgggcaaacaacaccctttagatttagggtattaatttgtacacatt |
20810841 |
T |
|
| Q |
204 |
ttgagttcaagttaacaattagctccatgtttgaataatactacgttc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20810842 |
ttgagttcaagttaacaattagctccatgtttgaataatactacgttc |
20810889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University