View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3125_low_30 (Length: 215)
Name: NF3125_low_30
Description: NF3125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3125_low_30 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 42272790 - 42272576
Alignment:
| Q |
1 |
aaacattcaacccgacctaatcaagtttgtttggtttgggtaataaaactcgttttttgtttgcttgcattaatctcaaaccaactcaatgatgatcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42272790 |
aaacattcaacccgacctaatcaagtttgtttggtttgggtaaaaaaactcgttttttgtttgcttgcattaatctcaaaccaactcaatgatgagcatt |
42272691 |
T |
|
| Q |
101 |
cgtttgggtcatccaagtgtagttttgagatgacaaccaatgtatgttcgttgcggcaggtcacaattgcccttcattagagtagggtggtgtacctgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42272690 |
cgtttgggtcatccaagtgtagttttgagatgacaaccaatgtatgttcgttgcggcaggtcacaattgcccttcattagagtaaggtggtgtacctgca |
42272591 |
T |
|
| Q |
201 |
aggactccaacactt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42272590 |
aggactccaacactt |
42272576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University