View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3126_high_6 (Length: 237)
Name: NF3126_high_6
Description: NF3126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3126_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 29 - 220
Target Start/End: Complemental strand, 22328167 - 22327976
Alignment:
| Q |
29 |
tggtgttgaagaacatgtagctgtggggttccaagcggggaggtgagcgagttcgtcgatagcagatttagcttttttaatgagccaatcaactgcttta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22328167 |
tggtgttgaagaacatgtagctgtggggttccaagcggggaggtgagcgagttcgtcgatagcagatttagcttttttaatgagccaatcgactgcttta |
22328068 |
T |
|
| Q |
129 |
cttggccggtcgtagccgagacgatcttgcacgtcgtagatttgaatcgcagtgttggctgagagtcgtgcacggcggtcccggggaccttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
22328067 |
cttggccggtcgtagccgagacgatcttgcacgtcgtagaattgaatcgcagtgtgggctgagagtcgtacacggcggtcacggggaccttt |
22327976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 99 - 196
Target Start/End: Original strand, 30768316 - 30768413
Alignment:
| Q |
99 |
gcttttttaatgagccaatcaactgctttacttggccggtcgtagccgagacgatcttgcacgtcgtagatttgaatcgcagtgttggctgagagtcg |
196 |
Q |
| |
|
||||| || ||||||||||| |||||||| ||||| | |||||||||||| |||||||| || ||||||| || || || |||| ||||||||||| |
|
|
| T |
30768316 |
gctttcttgatgagccaatccactgctttgcttggtctgtcgtagccgaggcgatcttgaacatcgtagaattcgatggctgtgtgtgctgagagtcg |
30768413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 90 - 175
Target Start/End: Original strand, 39077281 - 39077366
Alignment:
| Q |
90 |
gcagatttagcttttttaatgagccaatcaactgctttacttggccggtcgtagccgagacgatcttgcacgtcgtagatttgaat |
175 |
Q |
| |
|
||||| ||||| ||||| || ||||||||||| |||||||| || | ||||||||||||||| ||||| || || |||| |||||| |
|
|
| T |
39077281 |
gcagacttagcctttttgataagccaatcaacagctttactcggtctgtcgtagccgagacggtcttgaacatcatagaattgaat |
39077366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University