View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3126_low_10 (Length: 229)
Name: NF3126_low_10
Description: NF3126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3126_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 23 - 218
Target Start/End: Complemental strand, 1240950 - 1240755
Alignment:
| Q |
23 |
tgctcttgatcactcatcttgtgttggaaaactcatttcttatgtttccttcatcttccttactttcattgttcctctcttcacaaccctatttgttcaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1240950 |
tgctcttgatcactcatcttgtgttggaaaactcatttcttatgtttccttcatcttccttactttcgttgttcctctcttcacaaccctatttgttcaa |
1240851 |
T |
|
| Q |
123 |
gtatctgcttcttctcctgaagttgatcctatctccttgaacaagcttgttcaaatacctgaatctgcacttgccatcatttccttcttctctctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1240850 |
gtatctgcttcttctcctgaagttgatcctatctccttgaacaagcttgttcaaatacctgaatctgcacttgccatcatttccttcttcactctc |
1240755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University