View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3126_low_5 (Length: 328)
Name: NF3126_low_5
Description: NF3126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3126_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 11 - 310
Target Start/End: Original strand, 32180008 - 32180307
Alignment:
| Q |
11 |
cagagaaggaggaacaaaggaacatcctagtgttagagatgagtgagagcttgtcttgttaggtgttggaggaaaaatgacagcttttcatcttgttatg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32180008 |
cagaaaaggaggaacaaaggaacatcctagtgttagagatgagtgagagcttgtcttgttaggtgttggaggaaaaatgacaacttttcatcttgttatg |
32180107 |
T |
|
| Q |
111 |
tgctgagtggcatattgtcttatttgagtttctcttaccgtcgatgtttcttgtgatgataccttcttttgcttgtttgatgaagaaaatgagaacgagg |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32180108 |
tgctgagtgacatattgtcttatttgagtttctcttaccgtcaatgtttcttgtgatgataccttcttttgcttgtttgatgaagaaaatgagaacgagg |
32180207 |
T |
|
| Q |
211 |
gaagaaattgtttgtcttgacaagaaactgagggatagtagaagggagaaaagtcaggtgcgtttattaatatcatgtgtgttttttgaaatggtgtaat |
310 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32180208 |
gaagaaattgtttgtcttaacaagaaactgagggatagtagaagggagaaaagtcaggtgcgtttattaatatcatgtgtgttttttgaaacggtgtaat |
32180307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University