View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3128-Insertion-20 (Length: 263)
Name: NF3128-Insertion-20
Description: NF3128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3128-Insertion-20 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 114 - 263
Target Start/End: Complemental strand, 31935083 - 31934934
Alignment:
| Q |
114 |
tcagtttataagtccgaaggattcaaggttgaagactcaaatcaagtggaactnnnnnnnnttgttaaatttaatcaattgtcaatatccactataacta |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || || || || |
|
|
| T |
31935083 |
tcagtttacaagtccgaaggattcaaggttgaagactcaaatcaagtggaactaaaaaaaattgttaaatttaatcaattgtcaatattcattaaaaata |
31934984 |
T |
|
| Q |
214 |
aaaatgagaatatttacaccttatataggtacaatctctccatcccctac |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31934983 |
aaaatgagaatatttacaccttatataggtacaatctctccatcccctac |
31934934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 91
Target Start/End: Complemental strand, 31935162 - 31935103
Alignment:
| Q |
30 |
tgtgatatttgattgaccaaactctaaaataaggttttctgaaagactaagttagagaatac |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||| |
|
|
| T |
31935162 |
tgtgatatttgattgaccaaactctaaaataaggcttcctgaaagactaa--tagagaatac |
31935103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University