View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3128-Insertion-24 (Length: 246)
Name: NF3128-Insertion-24
Description: NF3128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3128-Insertion-24 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 7 - 246
Target Start/End: Original strand, 27475284 - 27475525
Alignment:
| Q |
7 |
aagttcattgttcatccaaccccctaaaatgttccattctctcgctatttctttacatttctcaaactatttgcttccaccttctcacatttcgatctca |
106 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27475284 |
aagttcattgttcatccaaccccccaaaatgttccattctctcgctatttctttacatttctcaaactatttgcttccaccttctcacatttcgatctca |
27475383 |
T |
|
| Q |
107 |
cactttttggtatataatgattcaactttgaacct-aatacttaatcttttcatttgatcctgttattacagwcaaattgtcct-ggggttcgtatgtcc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||| ||| |
|
|
| T |
27475384 |
cactttttggtatataatgattcaactttgaacctgaatatttaatcttttcatttgatcctgttactacagtcaaattgtcctgggggttcgtatctcc |
27475483 |
T |
|
| Q |
205 |
tcttccttcccggtgtagctttcaagctttttgtgtttttct |
246 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
27475484 |
tcttccttcccggtgtggctttcaagttttttgtgtttttct |
27475525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University