View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3128_high_22 (Length: 323)
Name: NF3128_high_22
Description: NF3128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3128_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 41185931 - 41185619
Alignment:
| Q |
1 |
tcctcgatacatgtttggcaaaggtgcaacaatctcatgaattcatggattgttaactc--gttgttccgcctatatattgcacaagtcgtcttgttaga |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
41185931 |
tcctcgatacatgtttggcaaaggtgcaacaatctcatgaattcatggattgttaactcaggttgctccgcctatatattgcacaagtcatcttgttaga |
41185832 |
T |
 |
| Q |
99 |
ggatactactccatccagttgacaaccggttattataaccagttacatttaagtaatagatgatagaaagttagttataacagattacttgtgttacaag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41185831 |
ggatactactccatccagttgacaaccggttattataaccagttacatttaagtcatagatgatagaaagttagttataacagattacttgtgttacaag |
41185732 |
T |
 |
| Q |
199 |
tcacctagctttattccctnnnnnnnnnnnnnnnatgattcttgtaattaactttcagttcatgccattcatttcaatatatgatatttctttgtttacc |
298 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41185731 |
tcacctagctttattcact----tgtgtgtgtgtatgattcttgtaattaactttcagttcatgccattcatttcaatatatgagatttctttgtttacc |
41185636 |
T |
 |
| Q |
299 |
tctctgattttcatctc |
315 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41185635 |
tctctgattttcatctc |
41185619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University