View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3128_high_23 (Length: 319)
Name: NF3128_high_23
Description: NF3128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3128_high_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 112 - 300
Target Start/End: Original strand, 4599892 - 4600080
Alignment:
| Q |
112 |
tcagagtctaagatatgtttattttaaaatggaatgattccaagtaatacaatttgagccttatcctcattgtgacaaagattgatcttgaatcctctca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4599892 |
tcagagtctaagatatgtttattttaaaatggaatgattccaagtaatacaatttgagccttatcctcattgtgacaaagattgatcttgaatcctctca |
4599991 |
T |
|
| Q |
212 |
ataatcgatgtatactagtctagtcacaactttttgctatgccagaaattaatttgaattattcacaattatgtttagaatctgcagac |
300 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4599992 |
ataatcgatgcatactagtctagtcaaaactttttgctatgccagaaattaatttgaattattcacaattatgtttagaatctgcagac |
4600080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 4599781 - 4599848
Alignment:
| Q |
1 |
gaaaatgagaaagggatgagtcaatggtttaataattgagataaaagccaatgtcccttggatttgtg |
68 |
Q |
| |
|
||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4599781 |
gaaaatgagaaaggggtatgtcagtggtttaataattgagataaaagccaatgtcccttagatttgtg |
4599848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University