View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3128_high_26 (Length: 278)
Name: NF3128_high_26
Description: NF3128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3128_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 21 - 212
Target Start/End: Complemental strand, 31530622 - 31530431
Alignment:
| Q |
21 |
cagtaatatatacatgtttttagttaggtgtggcgtggattttcaaccgattcttttccattgttgtaagtcttgttaaaccttattattggactcgtta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31530622 |
cagtaatatatacatgtttttagttaggtgtggcgtggattttcaaccgattcttttccattgttgtaagtcttgttaaaccttattattggactcgtta |
31530523 |
T |
 |
| Q |
121 |
atatactttatcaattggcttggtttgccacggaaaaaacctgaatagctttagagaatgttgcaacctatgacctaattcaatggccaaaa |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31530522 |
atatactttatcaatcggcttggtttgccactgaaaaaacctgtatagctttagagaatgttgcaacctatgacctaattcaatggccaaaa |
31530431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University