View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3128_high_35 (Length: 249)
Name: NF3128_high_35
Description: NF3128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3128_high_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 32169026 - 32168791
Alignment:
| Q |
1 |
caaatggcacaaccaaggaaattttcttggcatgtgtgtgtattacaattnnnnnnnnntgtagaagtgttaatatttccttagtcaaacccataatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169026 |
caaatggcacaaccaaggaaattttcttggcatgtgtgtgtattacaattaaaaaaaaatgtagaagtgttaatatttccttagtcaaacccataatcca |
32168927 |
T |
 |
| Q |
101 |
ccacttgacaaagggattcatattgataaacctcactatgatcaaatgtgccaagcccttccttctcatcatggttttaaatgcagtcgcgattgcggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32168926 |
ccacttgacaaagggattcatattgataaacctcactatgatcaaatgtgccaagcccttccttctcatcatggttttaaatgcagtcgcgattgcggtt |
32168827 |
T |
 |
| Q |
201 |
acactgcaaacttttatattgtggaaaaatggagaa |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32168826 |
acactgcaaacttttatattgtggaaaaatggagaa |
32168791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 193 - 229
Target Start/End: Original strand, 24913940 - 24913976
Alignment:
| Q |
193 |
ttgcggttacactgcaaacttttatattgtggaaaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24913940 |
ttgcggttacactgcaaacttttatattgtggtaaaa |
24913976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 191 - 230
Target Start/End: Complemental strand, 12155943 - 12155904
Alignment:
| Q |
191 |
gattgcggttacactgcaaacttttatattgtggaaaaat |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
12155943 |
gattgcggttacactgcaaacttttatattgcggcaaaat |
12155904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University