View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3128_high_45 (Length: 237)
Name: NF3128_high_45
Description: NF3128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3128_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 223
Target Start/End: Complemental strand, 52562901 - 52562682
Alignment:
| Q |
10 |
aatattccttatagaaacattcaccaccaacatgaacgcgacacaactaaattcccaatttcttcttcttctt------tctcagacaaattaggggttt |
103 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52562901 |
aatatcccttatagaaacattcaccaccaacatgaacgcgacacaactaaattcccaatttcttcttcttcttcttctttctcagacaaattaggggttt |
52562802 |
T |
 |
| Q |
104 |
ctggaaaagctcttgtttcaacacttccaccacaacctgaacagccggaaccttcgaaattgctcactctgcccaccattctcactcttggccgtgtcgc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52562801 |
ctggaaaagctcttgtttcaacacttccaccacaacctgaacagccggaaccttcgaaattgctcactctgcccaccattctcactcttggccgtgtcgc |
52562702 |
T |
 |
| Q |
204 |
cgcagtcccccttcttgttg |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
52562701 |
cgcagtcccccttcttgttg |
52562682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University