View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3128_high_47 (Length: 222)
Name: NF3128_high_47
Description: NF3128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3128_high_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 33519577 - 33519366
Alignment:
| Q |
1 |
ccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaacctaggcaactggctcccaagaatagagcgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519577 |
ccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaacctaggcaactggctcccaagaatagagcgcat |
33519478 |
T |
|
| Q |
101 |
atcagcagggtactcgccaaaaactaggggatctagtaaccttgccatcagaagagcggaaaaagttactaagaaagaacgatatagccattttctttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33519477 |
atcagcagggtactcgccaaaaactaggggatctagtaaccttgccatcagaagagcggaaaaagttactaagaaagaacgatagagccattttctttta |
33519378 |
T |
|
| Q |
201 |
attcatctcact |
212 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
33519377 |
attcatgtcact |
33519366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 6 - 143
Target Start/End: Original strand, 33496384 - 33496521
Alignment:
| Q |
6 |
tagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaacctaggcaactggctcccaagaatagagcgcatatcag |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |||| | | |||||| || ||||||||||||||||||| |||| |
|
|
| T |
33496384 |
tagttattgatgccaatgaagtccaggctgcctcttaggagactcttctccttcgtagagatctttggcaaccggttcccaagaatagagcgcatctcag |
33496483 |
T |
|
| Q |
106 |
cagggtactcgccaaaaactaggggatctagtaacctt |
143 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33496484 |
cagggtactcaccaaaaactaggggatctagtaacctt |
33496521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University