View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3128_low_13 (Length: 383)
Name: NF3128_low_13
Description: NF3128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3128_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 359
Target Start/End: Original strand, 14220339 - 14220695
Alignment:
| Q |
1 |
tcaatatagccataaatctccacacgtgagcattgcaaagtcacgtggaagagctccctccagtccaccttgaaatcaaaaacaacattgttgtttggtt |
100 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14220339 |
tcaatttagacataaatctccacacgtgagcattgcaaagtcacgtggaggagttccctccactccaccttgaaatcaaaaacaacattgttgtttggtt |
14220438 |
T |
|
| Q |
101 |
tggcgttccctcagaatctcttttggaggcaaaaatgcgtctcaacaaatgcaactgtgcgtttcatgtaatcacttcttttcattcccaaaccctagcc |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14220439 |
tggcgttccctcagaatcacttttggaggcaaaaatgcgtctcaacaaatgcaactatgcgtttcatgtaatcacttcttttcattcccaaaccctagcc |
14220538 |
T |
|
| Q |
201 |
tcttatttctctctctgctcttcacttgcggccgcgatccattcttcccaagctcggaagttgtaacatcaggtaaaccttttcttcccagtctcttcan |
300 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14220539 |
tcttatttctctctcttctcttcacttgcggccgagatccattcttcccaagctcggaagttgtaacatcaggtaaaccttttcttccc--tctcttcat |
14220636 |
T |
|
| Q |
301 |
nnnnnnaacatcaagattattagggtagtaaacactgnnnnnnnacttattcatgtact |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14220637 |
tttttcaacatcaagattattagggtagtaaacactgtttttttacttattcatgtact |
14220695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University