View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3128_low_31 (Length: 269)
Name: NF3128_low_31
Description: NF3128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3128_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 10 - 250
Target Start/End: Complemental strand, 10930700 - 10930458
Alignment:
| Q |
10 |
aatattaaaaggaccaaattacatccactttctatgaga--taaaccccggatgtacaaaaacatgtagagatcaaaatccttacaatacaaaaaatgca |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10930700 |
aatattaaaaggaccaaattacatccactttctatgagagataaaccccggatgtacaaaaacatgtagagatcaaaatccttacaatacaaaaaaagca |
10930601 |
T |
|
| Q |
108 |
gctaaaatacttcgagatgaagtattaccccaaacaggaaacacctatatacatcctactactatcgacactgatgatgttactacttatacacctctcg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10930600 |
gctaaaatacttcgagatgaagtattaccccaaacaggaaacacctatatacatcctactactatcgacactgatgatgttactacttatacacctctcg |
10930501 |
T |
|
| Q |
208 |
ttacaagtttaatacccctcacccaaagcttagcagcttctga |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10930500 |
ttacaagtttaatacccctcacccaaagcttagcagcttctga |
10930458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University