View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3128_low_48 (Length: 239)
Name: NF3128_low_48
Description: NF3128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3128_low_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 220
Target Start/End: Original strand, 4210592 - 4210797
Alignment:
| Q |
16 |
tgtgatcgaggtgtggagtgttcccctgtttgcacttcttgttaagattttggagaggatttttcgacgtgttttttcaatgcagcatcagtctattggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4210592 |
tgtgatcgaggtgtggagtgttcccctgtttgcacttcttgttaagattttggagaggatttttggacgtgttttttcaatgcagcatcagtctattggt |
4210691 |
T |
|
| Q |
116 |
ttggcaagagtgcggcacttgggatcagttgcagaa-ttttttgacaacgcctgcagtaacagtgcaacgtttgtgcactcattttatccgatgtgtccg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
4210692 |
ttggcaagagtgcggcacttgggatcagttgcagaatttttttgacaacgcctgcagtaacagtgcaacatttgtacactcattttatccgatgtgtccg |
4210791 |
T |
|
| Q |
215 |
gtgata |
220 |
Q |
| |
|
|||||| |
|
|
| T |
4210792 |
gtgata |
4210797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University