View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3131_high_14 (Length: 233)
Name: NF3131_high_14
Description: NF3131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3131_high_14 |
 | |
|
| [»] scaffold0657 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0657 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: scaffold0657
Description:
Target: scaffold0657; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 63 - 233
Target Start/End: Complemental strand, 6591 - 6423
Alignment:
| Q |
63 |
tttctgatttaagtaaaatttcctacggaattgtttaggaggaaataaataatttattgatttcgtgtaaatgtannnnnnnnnattgatatcgttttga |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6591 |
tttctgatttaagtaaaatttcctacggaattgtttaggatgaaataaataatttattgatttcgtgtaaatgtatttttttg-attgatatcgttttga |
6493 |
T |
|
| Q |
163 |
ttgtggtttaagagaaagagctgaaaaaattgaaaagtggtatgattatgcatcttgtgtgtaatacaact |
233 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
6492 |
ttgtggtttaagagaaagagctga-aaaattgaaaagtggtatgattgtgtatcttgtgtgtaatacaact |
6423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0657; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 13 - 82
Target Start/End: Complemental strand, 7406 - 7337
Alignment:
| Q |
13 |
gtattttgttttctggtgtctatcactgaatgtattccctgtttttgttgtttctgatttaagtaaaatt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
7406 |
gtattttgttttctggtgtctatcactgaatgtattccctgtttttgttgtttctgttttatgtaaaatt |
7337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University