View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3131_high_15 (Length: 222)
Name: NF3131_high_15
Description: NF3131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3131_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 45304838 - 45305025
Alignment:
| Q |
18 |
ggcaaaagagtaaattgaccttggaacgaggagagaacctcattgaggtcggagtggcaggaggaagaaacggagagtgtgtggtggagacattgagaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45304838 |
ggcaaaagagtaaattgaccttggaacgaggagagaacctcattgaggtcggagtggcaggaggaagaaacggagagtgtgtggtggagacattgagaga |
45304937 |
T |
 |
| Q |
118 |
tgatgttgagatcacggtcattagcgggatcttgcaaaacctcaatgaggtcgtcgcttatggaaataagctgatccacgtcgaagtt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45304938 |
tgatgttgagatcacggtcattagcgggatcttgcaaaacctcaatgaggtcgttgcttatggaaataagctgatccacgtcgaagtt |
45305025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 103 - 202
Target Start/End: Complemental strand, 25738602 - 25738503
Alignment:
| Q |
103 |
ggagacattgagagatgatgttgagatcacggtcattagcgggatcttgcaaaacctcaatgaggtcgtcgcttatggaaataagctgatccacgtcgaa |
202 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||| |||||||| ||||||| |||||||| || |||||||| ||||||||| || || | || ||||||||| |
|
|
| T |
25738602 |
ggagacattgacagaggatgttgagttcacgatcattagcaggatctttcaaaaccttaacgaggtcgttgcttatggagatcagatcattcacgtcgaa |
25738503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University