View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3131_high_17 (Length: 201)
Name: NF3131_high_17
Description: NF3131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3131_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 8 - 186
Target Start/End: Complemental strand, 48528221 - 48528043
Alignment:
| Q |
8 |
tcgaagaaaataaaaatattgtttagcatatttgattttcagttgggaaaatctcaaatcatgttataaaatgggacgcggccatataaggatagatgtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48528221 |
tcgaagaaaataaaaatattgtttagcatatttgattttcagttgggaaaatctcaaatcatgttataaaatgggacgcggccatataaggatagatgtt |
48528122 |
T |
 |
| Q |
108 |
tattttaggtgatataataagaaccattcacttcataaaaaacaaattattgttttgtttgtttattttaggtgatttt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48528121 |
tattttaggtgatataataagaaccattcacttcataaaaaacaaattattgttttgtttgtttattttaggtgatttt |
48528043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University