View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3131_low_17 (Length: 201)

Name: NF3131_low_17
Description: NF3131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3131_low_17
NF3131_low_17
[»] chr3 (1 HSPs)
chr3 (8-186)||(48528043-48528221)


Alignment Details
Target: chr3 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 8 - 186
Target Start/End: Complemental strand, 48528221 - 48528043
Alignment:
8 tcgaagaaaataaaaatattgtttagcatatttgattttcagttgggaaaatctcaaatcatgttataaaatgggacgcggccatataaggatagatgtt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48528221 tcgaagaaaataaaaatattgtttagcatatttgattttcagttgggaaaatctcaaatcatgttataaaatgggacgcggccatataaggatagatgtt 48528122  T
108 tattttaggtgatataataagaaccattcacttcataaaaaacaaattattgttttgtttgtttattttaggtgatttt 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48528121 tattttaggtgatataataagaaccattcacttcataaaaaacaaattattgttttgtttgtttattttaggtgatttt 48528043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University