View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3132-Insertion-5 (Length: 235)
Name: NF3132-Insertion-5
Description: NF3132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3132-Insertion-5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 235
Target Start/End: Complemental strand, 39512518 - 39512303
Alignment:
| Q |
20 |
gtatataacttatgacatttgcgggtatcactacgaggttaaaacctttgcctcaataatactcagatcgggctattagccaaccatgagaagagatcgt |
119 |
Q |
| |
|
|||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39512518 |
gtatataacttaagacatttgcaggtatcacgacgaggttaaaacctttgcctcaataatactcagatcgtgctattagccaaccatgagaagagatcgt |
39512419 |
T |
|
| Q |
120 |
gcataatctgtacagaaatctgataagcgtcaaagatttgtaaattcaccacatcaaccaccattggtgctacatcaggtggtgacatattgacctttca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39512418 |
gcataatctgtacagaaatctgataagcgtcaaagatttgtaaattcaccacatcaaccaccattggtgctacatcaggtggtgacatcttgacctttca |
39512319 |
T |
|
| Q |
220 |
atacttaaaagttaga |
235 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
39512318 |
atacttagaagttaga |
39512303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University