View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3132-Insertion-6 (Length: 167)
Name: NF3132-Insertion-6
Description: NF3132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3132-Insertion-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 2e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 2e-81
Query Start/End: Original strand, 7 - 167
Target Start/End: Complemental strand, 3650901 - 3650741
Alignment:
| Q |
7 |
agtttggactacaactacgtcctgcttagttttttagctataaaaaggttttatattatattttgtctgagtttatgaacgtttttggtcttttggggct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3650901 |
agtttggactacaactacgtcctgcttagttttttagctataaaaaggttttatattatattttgtctgagtttatgaacgtttttggtcttttggggct |
3650802 |
T |
|
| Q |
107 |
tgaaaatgataatgtttcttgctttctgttgattgtgcacatgttggtacttggtaagata |
167 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3650801 |
tgaaaattataatgtttcttgctttctattgattgtgcacatgttggtacttggtaagata |
3650741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University