View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3132R-Insertion-6 (Length: 190)
Name: NF3132R-Insertion-6
Description: NF3132R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3132R-Insertion-6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 9 - 190
Target Start/End: Original strand, 53911236 - 53911417
Alignment:
| Q |
9 |
atacagttattggcgacaataaacaatttgtgaaacaaaagtttgttaataaaagcaatagcaataaatcttacaagaaggatccgaagctttggcttct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53911236 |
atacagttattggcgacaataaacaatttgtgaaacaaaagtttgttaataaaaacaatagcaataaatcttacaagaaggatccgaagctttggcttct |
53911335 |
T |
|
| Q |
109 |
cggggctatctctctttcccttgcaataagtaaccaccgcaatctcagcaccgtagcctttgtttccagctttaactgtctc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53911336 |
cggggctatctctctttcccttgcaataagtaaccaccgcaatctcagcaccgtagcctttgtttccagctttaactgtctc |
53911417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University