View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3133_low_13 (Length: 235)
Name: NF3133_low_13
Description: NF3133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3133_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 4969592 - 4969377
Alignment:
| Q |
1 |
attgaggtccatttctaatctttgttatctgatttcgcgttttaattttcatttgtac-atccactaatggttcaaaattattctcctatattttgggtt |
99 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4969592 |
attgaggtccatttataatctttgttatctaatttcgcgttttaattttcatctgtaccatccactaatggttaaaaattattctcctatattttgggtt |
4969493 |
T |
 |
| Q |
100 |
gatccatttcgannnnnnnnnnnnnnnn--ctaatcttatctaaaacttactgtttaatgatcattttgattttgatattaatgcttttccaaataattt |
197 |
Q |
| |
|
||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4969492 |
gatttatttcgattttttttaagtttttttctaatcttatctaaaacttactgtttaatgatcattttgattttgatattaatgcttttgcaaataattt |
4969393 |
T |
 |
| Q |
198 |
gaagcatggtttgagg |
213 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4969392 |
gaagcatggtttgagg |
4969377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University