View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3134_low_10 (Length: 240)
Name: NF3134_low_10
Description: NF3134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3134_low_10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 240
Target Start/End: Complemental strand, 43901760 - 43901534
Alignment:
| Q |
14 |
tgtttatcatagtgtgttgtccacagcattacaccgccatagttacgtgatatccttaaaacaggaagtacaatctcacacaacaaatcagctggaacat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43901760 |
tgtttatcatagtgtgttgtccacagcattacaccgccatagttacgcgatatccttaaaacaggaactacaatctcacacaacaaatcagctggaacat |
43901661 |
T |
|
| Q |
114 |
agccattatctgctgctgcaggggaagcaggcaatcccaaaaacacttttcccgacgttaacgactttgtccatcgcttccacgaatccaacaagcggtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43901660 |
agccattatctgctgctgcaggggaagcaggcaatcccaaaaacacttttcccgacgttaacgactttgtccatcgcttccacgaatccaacaagcggtt |
43901561 |
T |
|
| Q |
214 |
aacctcgctttcactatagtcacattc |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43901560 |
aacctcgctttcactatagtcacattc |
43901534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University