View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3135_low_5 (Length: 308)
Name: NF3135_low_5
Description: NF3135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3135_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 51 - 258
Target Start/End: Complemental strand, 40958220 - 40958011
Alignment:
| Q |
51 |
catatcaaatggaaatatgtatgacctctaccaactctacaaataatagatcaagacccaaggatttttacaatcttgttaattccatgccaaatacaag |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40958220 |
catatcaaatggaaatatgtatgacctctaccaactctacaaataatagatcaagacccaaggatttttacaatcttgttaattccatgccaaatacaag |
40958121 |
T |
|
| Q |
151 |
aatcacccggtttaaaagaagtatgaagaatacgagtattagacaaatatttggactg--agtttttggggttggttcaagatatcctaaatgtggttac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40958120 |
aatcacccggtttaaaagaagtatgaagaatacgagtattagacaaatatttggactgaaagtttttggggttggttcaagatatcctaaatgtggttac |
40958021 |
T |
|
| Q |
249 |
caaataaatt |
258 |
Q |
| |
|
|||||||||| |
|
|
| T |
40958020 |
caaataaatt |
40958011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 40958303 - 40958262
Alignment:
| Q |
13 |
aatatcacataggtgaagattggtgtcataaatatgaacata |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40958303 |
aatatcacataggtgaagattggtgtcataaatatgaacata |
40958262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University