View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3135_low_8 (Length: 210)
Name: NF3135_low_8
Description: NF3135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3135_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 52113512 - 52113712
Alignment:
| Q |
1 |
ttgttgtttctattggagtaattggagttnnnnnnnatgtcttatctgggttggacactgatgctttcaatggagtgactgaaattggaatgaaaggaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
52113512 |
ttgttgtttctattggagtaattggaattggggaggatgtcgtatctgggttggacactgatgctttcaatggagtcgctgaaattggagtgaaaggaca |
52113611 |
T |
|
| Q |
101 |
tttggaaatggagcagcgattgcggtgttttatcgttctttttaatgcaaattctggttgaaggaaagtataagatattgaggaggtaagtgatgatgat |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113612 |
tttggaaatggagcagcgattgtggtgttttatcgttcttttaaatggaaattctggttgaaggaaagtataagatattgaggaggtaagtgatgatgat |
52113711 |
T |
|
| Q |
201 |
g |
201 |
Q |
| |
|
| |
|
|
| T |
52113712 |
g |
52113712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University