View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3136_high_14 (Length: 330)
Name: NF3136_high_14
Description: NF3136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3136_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 34598282 - 34598589
Alignment:
| Q |
1 |
cctataaatattgagtatgatgggaagagtggagcctcttgcatcatcaattcaatcctcaatccccatatatggctgcccacagtacaaattatcgtct |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34598282 |
cctataaatattgagtatgatgg-aagagtggagcctcttgcatcatcaattcaatcctcaatccccatatatgtctgcccacagtacaaattatcgtct |
34598380 |
T |
|
| Q |
101 |
ttatccattgtaaggacaaattcatgttatatggaatgcttatgtaagggatcattgttaagttgctatcacaataggttctaacttcttatccggaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34598381 |
ttatccattgtaaggacaaattcatgttatatggaatgcttatgtaagggatcattgttaagttgctatcacaataggttctaacttcttatccggaaac |
34598480 |
T |
|
| Q |
201 |
gttatcccaaaagattccaatttccttatctgaaaattaaataaatagatttatttaatgtggggaaggctacatctatatttgtgattttgttttcttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
34598481 |
gttatcccaaaagattccaatttccttatctgaaaattaaataaatagatttatttaatgtggggaaggctacatc----tttgtccttttgttttcttt |
34598576 |
T |
|
| Q |
301 |
cggtagactactg |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34598577 |
cggtagactactg |
34598589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University