View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3136_high_19 (Length: 280)
Name: NF3136_high_19
Description: NF3136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3136_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 5 - 261
Target Start/End: Original strand, 9614542 - 9614798
Alignment:
| Q |
5 |
gagcagcacagagacgcatgaacctcctccaagaaccgaagttattctctgcatcatacttaacaagaccaccaacctgattgccgagaagaaaacccat |
104 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
9614542 |
gagcaacacggagacgcatgaacctcctccaagaaccgaagttattctctgcatcatacttaacaagaccaccaacctgactgccgagaagaatacccat |
9614641 |
T |
 |
| Q |
105 |
agattccgtcatgaagccaaagggaaggttgtgagcttgaacccacatctcaatagtgtccatcggagaggttgttgggtcatcaccgaaggagactttc |
204 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9614642 |
agattctgtcatgaagccaaagggaaggttgtgagcttgaacccacatctcaatagtgtccaacggagaggttgttgggtcatcaccgaaggagactttc |
9614741 |
T |
 |
| Q |
205 |
tgcagcactagagggaagttatcaaagagccaaggaccagtacgaatcacacgttcc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9614742 |
tgcagcactagagggaagttatcaaagagccaaggaccagtacgaatcacacgttcc |
9614798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University