View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3136_high_21 (Length: 248)
Name: NF3136_high_21
Description: NF3136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3136_high_21 |
 |  |
|
| [»] scaffold1319 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 13319636 - 13319740
Alignment:
| Q |
1 |
aaggttaatttcatcttcgcgagttccccttactagggatgcttcatctggcacaatgaactactaactaacggtagtttgggtggtgcccagtcttctg |
100 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13319636 |
aaggttaacttcatcttcgcaagttccccttactagggatgcttcatctggcacaatgaactactaactaacggtagtttgggtggtgcccagtcttctg |
13319735 |
T |
 |
| Q |
101 |
agcta |
105 |
Q |
| |
|
||||| |
|
|
| T |
13319736 |
agcta |
13319740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 174 - 213
Target Start/End: Original strand, 13319810 - 13319849
Alignment:
| Q |
174 |
ctcttctcgctagggatttgttccccttttatatttttgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13319810 |
ctcttctcgctagggatttgttccccttttatatttttgt |
13319849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1319 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold1319
Description:
Target: scaffold1319; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 1087 - 1042
Alignment:
| Q |
178 |
tctcgctagggatttgttccc-cttttatatttttgttgtttggtg |
222 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
1087 |
tctcgctagggatttgtttcctcttttatatttttgttgtttggtg |
1042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University