View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3137_high_11 (Length: 215)
Name: NF3137_high_11
Description: NF3137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3137_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 20 - 72
Target Start/End: Complemental strand, 42392623 - 42392570
Alignment:
| Q |
20 |
aggttaaaaatttgactctcatttttaaacataaacattaaca-ttgtttgttt |
72 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42392623 |
aggttaaaaattcgactctcatttttaaacataaacattaacatttgtttgttt |
42392570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 132 - 181
Target Start/End: Complemental strand, 10717103 - 10717054
Alignment:
| Q |
132 |
catagttttaaaaaccggaccagtgatcgactcggccaaggtactgggtc |
181 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||| |||||||||| |
|
|
| T |
10717103 |
catagttttaaaaaccggaccggacatcgactcggtcaaagtactgggtc |
10717054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 129 - 196
Target Start/End: Complemental strand, 29679386 - 29679319
Alignment:
| Q |
129 |
gagcatagttttaaaaaccggaccagtgatcgactcggccaaggtactgggtctctggatcattggtc |
196 |
Q |
| |
|
||||||||||||||||| |||||| ||||| |||||||||||||||||| || |||| ||||||||| |
|
|
| T |
29679386 |
gagcatagttttaaaaatcggaccggtgattgactcggccaaggtactgaatcactgggtcattggtc |
29679319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 197
Target Start/End: Complemental strand, 31958737 - 31958672
Alignment:
| Q |
132 |
catagttttaaaaaccggaccagtgatcgactcggccaaggtactgggtctctggatcattggtcg |
197 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||| ||||| ||||| | |||| |||||||||| |
|
|
| T |
31958737 |
catagttttaaaaatcggatcggtgatcgactcggctaaggttctgggccactgggtcattggtcg |
31958672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 129 - 166
Target Start/End: Original strand, 20623146 - 20623183
Alignment:
| Q |
129 |
gagcatagttttaaaaaccggaccagtgatcgactcgg |
166 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||| |
|
|
| T |
20623146 |
gagcatagttttaaaaaccggaccggtcatcgactcgg |
20623183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 129 - 195
Target Start/End: Original strand, 7501376 - 7501442
Alignment:
| Q |
129 |
gagcatagttttaaaaaccggaccagtgatcgactcggccaaggtactgggtctctggatcattggt |
195 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||| || ||||||||||| | || |||||||| |
|
|
| T |
7501376 |
gagcatagttttaaaactcggaccggtgatcgactcggtcagggtactgggtcacagggtcattggt |
7501442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 166
Target Start/End: Complemental strand, 37032915 - 37032879
Alignment:
| Q |
130 |
agcatagttttaaaaaccggaccagtgatcgactcgg |
166 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| |
|
|
| T |
37032915 |
agcatagttttaaaaaccggaccggtcatcgactcgg |
37032879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 132 - 181
Target Start/End: Complemental strand, 56077520 - 56077471
Alignment:
| Q |
132 |
catagttttaaaaaccggaccagtgatcgactcggccaaggtactgggtc |
181 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
56077520 |
catagttttaaaaaccggaccggtgatcgactcggtaagggtactgggtc |
56077471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 166
Target Start/End: Original strand, 34856007 - 34856041
Alignment:
| Q |
132 |
catagttttaaaaaccggaccagtgatcgactcgg |
166 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
34856007 |
catagttttaaaaaccggaccagtcatcgactcgg |
34856041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 195
Target Start/End: Complemental strand, 21528944 - 21528881
Alignment:
| Q |
132 |
catagttttaaaaaccggaccagtgatcgactcggccaaggtactgggtctctggatcattggt |
195 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| || ||||||||||| | || |||||||| |
|
|
| T |
21528944 |
catagttttaaaactcggaccggtgatcgactcggtcagggtactgggtcacagggtcattggt |
21528881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 132 - 195
Target Start/End: Complemental strand, 51229613 - 51229550
Alignment:
| Q |
132 |
catagttttaaaaaccggaccagtgatcgactcggccaaggtactgggtctctggatcattggt |
195 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| || ||||||||||| | || |||||||| |
|
|
| T |
51229613 |
catagttttaaaactcggaccggtgatcgactcggtcagggtactgggtcacagggtcattggt |
51229550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 136 - 197
Target Start/End: Original strand, 24144602 - 24144663
Alignment:
| Q |
136 |
gttttaaaaaccggaccagtgatcgactcggccaaggtactgggtctctggatcattggtcg |
197 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| ||||| | |||||| || | |||||||||| |
|
|
| T |
24144602 |
gttttaaaacccggaccagtgatcgacccggtcaaggcattgggtcactaggtcattggtcg |
24144663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University