View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3137_high_7 (Length: 241)
Name: NF3137_high_7
Description: NF3137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3137_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 98 - 226
Target Start/End: Complemental strand, 39847613 - 39847485
Alignment:
| Q |
98 |
tacagcatatataactnnnnnnngagaaactacagagtttaccagattgcttatgtcgcgttcgtttttctccttcttcgacttttcgattcttttaatc |
197 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39847613 |
tacagcatatataactaaaaaaagagaaactacagagtttaccagattgcttatgtcgcgttcgtttttctcctccttcgacttttcgattcttttaatc |
39847514 |
T |
|
| Q |
198 |
gtgcttgttatctactgtaacgtaaaacc |
226 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
39847513 |
gtgcttgttatctactgtaacataaaacc |
39847485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 60 - 97
Target Start/End: Complemental strand, 39847668 - 39847631
Alignment:
| Q |
60 |
tcgaattccactaaacccaaaataatactaaagttgct |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39847668 |
tcgaattccactaaacccaaaataatactaaagttgct |
39847631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 39847751 - 39847706
Alignment:
| Q |
1 |
cacagatgcagatagatgcctctaacagcacacaagagcatgaatt |
46 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
39847751 |
cacagatgcagatagatgcctctaacaacacacaagaccatgaatt |
39847706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University