View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3137_high_8 (Length: 238)
Name: NF3137_high_8
Description: NF3137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3137_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 30742460 - 30742671
Alignment:
| Q |
17 |
acattgcataccatgtatataaccatctcttaaccttttccatagatttgttgataaccttaagatctttggttgaactttttccatcatttcaaaaaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30742460 |
acattgcataccatgtatataaccatctcttaaccttttccatagatttgttgataaccttaagatctttggttgaactttttccatcatttcaaaaaag |
30742559 |
T |
 |
| Q |
117 |
ttcaaattctttgaacctaacatagcaacattttcattaatattgcaatcactcacctctttgttgctcttgagcttatggtatatttttctctttgtgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30742560 |
ttcaaattctttgaacctaacatagcaacattttcattaatagtgcaatcactcacctctttgttgctcttgagcttatggtatatttttctctttgtgt |
30742659 |
T |
 |
| Q |
217 |
accctatgcttc |
228 |
Q |
| |
|
||| |||||||| |
|
|
| T |
30742660 |
accttatgcttc |
30742671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University